presentation
  JP Bourgin
  access
  contact
  job opportunities
  teaching resources
  Marie-Curie Site
  cell biology
  genetics & plant breeding
  plant nitrogen nutrition
  seed biology
  cell imaging
  biochemistry
  resource centre
IJPB
bc gap nap bs
iNRA
presentation unites services communs intranet liens plan du site
 

The V.A.S.T lab

Variation and Abiotic Stress Tolerance

 

     
   Projects  
   Publications  
   People  
   Arabidopsis RILs  
   New collections  
   MSAT Database  
   Useful Links  
     
 


The MSAT database was created to help you to find suitable markers for genotyping and mapping in Arabidopsis thaliana. Microsatellite loci are used as PCR-based markers, certainly the simplest to use and most highly polymorphic ones in any combination of accessions.

 


   Before going any further with the data, you should read the following technical explanations:
     Learn about the MSAT field meaning (columns headings)
     Find more on technical concerns (how to use our 'ESL' code, PCR conditions...)
   
  Description of the accessions (ecotypes) tested

  Keep in mind that the locus positions are given relative to the AGI V5 pseudo-molecules (complete sequence) from Feb. 2004.
  Always double-check the position of the primers on your reference sequence if you need to be sure of the physical location of the locus you are using. We are working sequences on the Signal website.
  Estimated sizes of PCR products may be rough and may come from different projects for different accessions. Always double-check and include specific heterozygotes you may need.

  Check the box in the first column and use the 'View' button for an easier reading of the data for a single marker.

 

   Page: 1 of 214  Records: 214

Chrom Marker Bac P1 Physic Position Pattern Amplif Length Col E Col S Col L Col E Ler S Ler L Ler E WS S WS L WS E Bay S Bay L Bay E Sha S Sha L Sha E C24 S C24 L C24 E Cvi S Cvi L Cvi E Fei S Fei L Fei E Fuk S Fuk L Fuk E Kas S Kas L Kas E Ll S Ll L Ll E Ri S Ri L Ri Forward Primer 5 3 Reverse Primer 5 3 Polymorphism tested by
Default Sort Order: Chrom
1 F5I6M F23A5 30192367 TA/GA 275 2 2 275 2 2 270 NA NA NA NA NA NA 0 NA NA 0 NA 280 2 2 275 NA NA NA 0 NA NA 0 NA NA NA NA NA 2 2 270 GACCCTAGAGGCAAACCAAATG AGTGAGTAAATGGTGGGGAATCG CNB-INIA
1 F19K23 F19K23 22942496 TTC 200 2 2 200 2 2 190 NA NA NA NA NA NA 2 2 205 2 2 200 2 2 200 2 2 200 2 2 200 2 2 200 2 2 200 2 2 200 GGTCTAATTGCCGTTGTTGC GAATTCTGTAACATCCCATTTCC CNB-INIA
1 F11P17-4615 F11P17 22601704 TTA 209 2 2 209 2 2 196 NA NA NA NA NA NA 2 2 185 2 2 200 2 2 185 2 2 195 2 2 190 2 2 190 2 2 209 2 2 185 CGCAATCGATTTTATTTAAATCC TTTCAGTTTGATGATTTATTCGC CNB-INIA
1 ATHGENEA F23C21 22400757 A 209 2 2 209 2 2 209 NA NA NA NA NA NA 2 2 170 2 2 209 2 2 214 2 2 212 2 2 209 2 2 212 2 2 214 2 2 209 ACCATGCATAGCTTAAACTTCTT ACATAACCACAAATAGGGGTG CNB-INIA
1 NGA280 F14J16 20877447 AG 105 2 2 105 2 2 85 NA NA NA NA NA NA 2 2 85 2 2 85 2 2 85 2 2 85 2 2 85 2 2 85 2 2 85 2 2 85 CTGATCTCACGGACAATAGTGC GGCTCCATAAAAAGTGCACC CNB-INIA
1 NGA128 F7A10 20633251 AG 180 2 2 180 2 2 190 2 2 170 2 2 170 2 2 190 2 1 180 2 1 160 2 1 187 2 1 180 2 1 175 2 1 175 2 1 165 GGTCTGTTGATGTCGTAAGTCG ATCTTGAAACCTTTAGGGAGGG Loudet / CNB-INIA
1 CIW1 F14J22 18367549 TA 159 2 2 159 2 2 135 NA NA NA NA NA NA 2 2 130 2 2 155 2 2 165 2 2 130 2 2 159 2 2 130 NA NA NA 2 2 130 ACATTTTCTCAATCCTTACTC GAGAGCTTCTTTATTTGTGAT CNB-INIA
1 T27K12 F7F22 15926702 AT 146 2 2 146 2 2 170 2 2 170 2 2 160 2 2 180 2 2 152 2 2 142 2 2 146 2 2 210 2 2 180 2 2 185 2 2 152 GGAGGCTATACGAATCTTGACA GGACAACGTCTCAAACGGTT Loudet / CNB-INIA
1 MSAT1.4 F28L22 14160180 AT 240 1 1 240 2 2 210 2 1 220 2 1 230 2 2 215 NA NA NA 2 2 210 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA CTAAACTAGAACCAGGGGTAA ACAAAAATCGTGGTGATAATA Loudet
1 CXC750 T8E3 11311082 CTT 700 2 2 700 0 NA NA NA NA NA NA NA NA 0 NA NA 0 NA NA 2 2 700 0 NA NA 0 NA NA 0 NA NA 0 NA NA 0 NA NA ATAATAGATAAAGAGCCCCACAC CGCCAAAGACTACGAAATGATC CNB-INIA
1 F5I14 F5I14 24374008 A 196 2 2 196 2 2 310 2 2 290 2 2 310 2 2 290 2 2 300 2 2 300 2 2 205 2 2 205 2 2 295 2 2 195 2 2 300 CTGCCTGAAATTGTCGAAAC GGCATCACAGTTCTGATTCC Loudet / CNB-INIA
1 MSAT1.12 T26J14 25686587 AT 183 2 2 183 2 2 175 2 2 160 1 1 200 2 2 175 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA TTAGAGATTCGCCAACCTC CGTGTGCCCAACCA Loudet
1 MSAT1.13 F24J5 25827433 AT 221 1 1 221 1 1 210 1 1 210 1 2 220 2 2 190 2 1 220 2 2 210 2 1 210 2 1 250 2 2 210 2 1 220 2 2 200 CAACCACCAGGCTC GTCAAACCAGTTCAATCA Loudet / CNB-INIA
1 yUP8H12R yUP8H12R 29835675 A 202 2 2 202 2 2 202 NA NA NA NA NA NA 2 2 202 2 2 202 2 2 202 2 2 202 2 2 202 2 2 202 2 2 202 2 2 202 GTGTTGCGTGTCGACCC AAATTTCAAAATGCGTATCC CNB-INIA
1 MSAT1.5 T14N5 29016886 AG 157 2 2 157 2 2 135 2 2 145 2 2 165 2 2 135 2 2 157 2 2 135 2 2 157 2 2 157 2 2 157 2 2 157 2 2 135 GCATCGCTCTTAAACAACCAT CGTTGCAAAACCGTATCAGAA Loudet / CNB-INIA
1 ADH1 F22K2O 28980409 GGT 287 2 2 287 2 2 287 NA NA NA NA NA NA 2 2 287 2 2 287 2 2 287 2 2 287 2 2 287 2 2 287 2 2 287 2 2 287 ACCACCGGACAGATTATTCG CCCAGAAGTAAACATCGGTGTG CNB-INIA
1 F22K20 F22K20 28895040 CT/AT 206 2 2 206 2 2 215 NA NA NA NA NA NA 2 2 209 2 2 200 2 2 206 2 2 215 2 2 206 2 2 206 2 2 215 2 2 206 TTTTTGGTGAGATTTTAAGCCC ATATCTCCATCGCTGCAACC CNB-INIA
1 MSAT1.2 F22K20 28894896 AG 164 1 1 164 1 1 180 1 2 155 1 1 180 1 1 160 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA TTGAGTGGTGCCGCTTG ATATCTCCATCGCTGCAACC Loudet
1 NGA692 F28O16 28841544 GA 119 2 2 119 2 2 110 NA NA NA NA NA NA 2 2 115 2 2 115 2 2 115 2 2 115 2 2 119 2 2 115 2 2 115 2 2 115 TTTAGAGAGAGAGAGCGCGG AGCGTTTAGCTCAACCCTAGG CNB-INIA
1 ATHATPASE T23E18 28537561 AG 85 2 2 85 2 2 69 NA NA NA NA NA NA 2 2 69 2 2 69 2 2 80 2 2 69 2 2 69 2 2 69 2 2 69 2 2 69 CTGGGAACGGTTCGATTCGAGC GTTCACAGAGAGACTCATAAACCA CNB-INIA
1 NGA111 F28P22 27356981 GA 150 1 2 150 1 2 155 NA NA NA NA NA NA 1 2 175 1 2 160 1 2 165 1 2 120 1 2 160 1 2 170 1 2 160 1 2 170 CTCCAGTTGGAAGCTAAAGGG TGTTTTTTAGGACAAATGGCG CNB-INIA
1 MSAT1.1 F20P5 26398711 AT 160 1 2 160 1 2 160 1 2 150 1 2 145 1 2 130 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA ATACGATAAGATTTATTAGCA CCCATGCTCTTTTTGTGAAA Loudet
1 ATHS0392 T5I8 10860075 AAG 142 2 2 142 2 2 156 NA NA NA NA NA NA 2 2 156 2 2 142 2 2 142 2 2 156 2 2 142 2 2 142 2 2 142 2 2 142 TTTGGAGTTAGACACGGATCTG GTTGATCGCAGCTTGATAAGC CNB-INIA
1 NGA248 F3H9 9887359 AG 143 2 2 143 2 2 130 2 2 135 2 2 150 2 2 140 2 2 130 2 2 165 2 2 165 2 2 145 2 2 145 2 2 130 2 2 130 TCTGTATCTCGGTGAATTCTCC TACCGAACCAAAACACAAAGG Loudet / CNB-INIA
1 NGA59 T25K16 8643 CT 111 2 2 111 2 2 115 NA NA NA NA NA NA 2 2 165 2 2 115 2 2 120 2 2 115 2 2 111 2 2 150 2 2 120 2 2 150 GCATCTGTGTTCACTCGCC TTAATACATTAGCCCAGACCCG CNB-INIA
1 F21M12 F21M12 3212191 GAAA 201 2 2 201 2 2 150 2 2 210 2 2 150 2 2 200 2 2 200 2 2 155 2 2 195 2 2 150 2 2 200 2 2 200 2 2 150 GGCTTTCTCGAAATCTGTCC TTACTTTTTGCCTCTTGTCATTG Loudet / CNB-INIA
1 F7G19 F7g19 2850463 A 197 2 2 197 2 2 190 NA NA NA NA NA NA 2 2 190 2 2 190 2 2 190 2 2 190 2 2 190 2 2 190 2 2 190 2 2 190 TTCAAAAATCGTGAGATGAAATG TCGTTGAAAACGATTAGATTGG CNB-INIA
1 ATEAT1 T7A14 1431412 AT 172 2 2 172 2 2 162 NA NA NA NA NA NA 2 2 162 2 2 157 2 2 157 2 2 167 2 2 165 2 2 162 2 2 167 2 2 162 GCCACTGCGTGAATGATATG CGAACAGCCAACATTAATTCCC CNB-INIA
1 T1G11 T1G11 1243352 A 207 2 2 207 2 2 190 2 2 190 2 2 190 2 2 200 2 2 198 2 2 198 2 2 198 2 2 198 2 2 198 2 2 190 2 2 190 GAAGACAAAGCTCTGCAGTAATG AATTGCATAAGGCACTTGAAAG Loudet / CNB-INIA
1 F19P19 F19P19 1157727 GA 202 2 2 202 2 2 192 NA NA NA NA NA NA 2 2 187 2 2 192 2 2 187 2 2 187 2 2 187 2 2 187 2 2 187 2 2 187 CCACGTAGGTCAAGAAGAAGAAG TGTCTGCTGCGATAGAGAGAG CNB-INIA
1 F20D22 F20D22 1070575 GTTT 201 2 2 201 2 2 195 NA NA NA NA NA NA 2 2 195 2 2 190 2 2 190 2 2 195 2 2 195 2 2 195 2 2 201 2 2 195 CCCAAGTGACGTCTGGTTTC AACAAAATGAGTTTCTCTGCATG CNB-INIA
1 F21B7 F21B7 923923 TAC 205 2 1 205 2 1 195 NA NA NA NA NA NA 2 2 205 2 1 205 2 2 195 2 1 220 2 1 215 2 1 215 2 1 205 0 NA NA CACGATATGATCAAGCTTTAACG TGACTACATGGAGATTATGGCC CNB-INIA
1 T7I23 T7I23 427343 TA 199 2 2 199 2 2 195 NA NA NA NA NA NA 2 2 185 2 2 204 2 2 190 2 2 185 2 2 185 2 2 185 2 2 185 2 2 195 CATGCACGTACGATTTGTTTAAC GTGTCCTTTTTTCTCAACGATG CNB-INIA
1 ATHACS F22L14 176325 A 281 2 2 281 2 2 271 NA NA NA NA NA NA 2 2 281 2 2 281 2 2 281 2 2 278 2 2 271 2 2 278 2 2 278 2 2 278 AGAAGTTTAGACAGGTAC AAATGTGCAATTGCCTTC CNB-INIA
1 NGA63 F21M12 3224558 GA 111 2 1 111 2 1 90 NA NA NA NA NA NA 2 1 90 2 1 111 2 1 90 2 1 92 2 1 92 2 1 90 2 1 100 2 1 90 AACCAAGGCACAGAAGCG ACCCAAGTGATCGCCACC CNB-INIA
1 ICE10 F12F1 4015381 GA 180 2 2 180 2 2 180 NA NA NA NA NA NA 2 2 170 2 2 164 2 2 160 2 2 140 2 2 180 2 2 140 2 2 185 2 2 155 AACATCCACAAGTTTCTAAAACAATC GACTCTTATGGGTAAGCTCCTTG CNB-INIA
1 ICE13 F3F19 4520017 ATC 225 2 2 225 2 2 225 NA NA NA NA NA NA 2 2 220 2 2 225 2 2 225 2 2 225 2 2 225 2 2 225 2 2 225 2 2 220 GATCCTTCACCGGGTCTTG GTGGTGGAGACTCTTCGAGC CNB-INIA
1 NGA392 F13K9 9831766 AG 170 2 2 170 2 2 162 NA NA NA NA NA NA 2 2 160 2 2 160 0 NA NA 2 2 160 2 2 160 0 NA NA 2 2 160 2 2 160 TTGAATAATTTGTAGCCATG GGTGTTAAATGCGGTGTTC CNB-INIA
1 CIW12 T22C5 9621344 AG 128 2 2 128 2 2 115 NA NA NA NA NA NA NA NA NA 2 2 100 2 2 120 2 2 150 2 2 105 2 2 105 2 2 115 2 2 135 AGGTTTTATTGCTTTTCACA CTTTCAAAAGCACATCACA CNB-INIA
1 ATHZFPG F21J9 8727055 CT 143 2 2 143 2 2 139 NA NA NA NA NA NA 2 2 135 2 2 148 2 2 139 2 2 143 2 2 135 2 2 135 2 2 135 2 2 139 TTGCGTTTCCACATTTGTTT TGGGTCAATTCACATGTAGAGA CNB-INIA
1 F21J9 F21J9 8655230 TTG 189 2 2 189 2 2 184 NA NA NA NA NA NA 2 2 184 0 NA NA 2 2 184 0 NA NA 0 NA NA 2 2 189 0 NA NA 2 2 184 CAGATTTCTTGCCAAGTTTCATC GAGACGAAGAAGATGGATTCTG CNB-INIA
1 MSAT1.3 F26F24 8322175 AT 266 2 2 266 2 2 230 2 2 230 2 2 230 2 2 230 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA GGAACTGTTGTCTGGGTAAG CGATTGCACTAAAAGCTCTC Loudet
1 F19G10 F19g10 8147245 GT 197 2 2 197 2 2 195 NA NA NA NA NA NA 2 2 195 2 2 195 2 2 195 2 2 195 2 2 195 2 2 195 2 2 195 2 2 197 AGTTGGTCCTCGAGCTCTCC AAGAACTTAATTTCTCTCACCCG CNB-INIA
1 MSAT1.7 F12K8 7987547 AT 300 2 2 300 2 2 300 2 2 300 2 2 280 2 2 270 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA GCTTTTATCAGCTCAAACAT ACTCTTACGTTTGGAGTTCA Loudet
1 MSAT1.10 F9H16 7296649 AT 235 2 2 235 2 1 210 0 NA NA 2 2 235 2 1 220 2 1 200 2 2 200 2 2 235 2 2 235 2 2 235 2 2 235 2 2 235 ATGGTGAGATACTGAGATTAT CGAGAAGGTCTAAAGGTA Loudet / CNB-INIA
1 ATHSRP54A F9L1 5268636 TA 247 2 2 247 2 2 245 NA NA NA NA NA NA 2 2 245 2 2 245 2 2 245 2 2 247 2 2 245 2 2 245 2 2 245 2 2 247 TGAATTATGGAATCAATGTTCG AAAAGGAACCCTACCAAAAACA CNB-INIA
1 JV18/19 F10B6 5160594 TA 280 2 2 280 2 2 285 NA NA NA NA NA NA 2 2 290 2 2 280 2 2 290 2 2 280 2 2 280 2 2 280 2 2 290 2 2 290 TGTCGTATATCAATCGAAAAAGAGAT AATTCAGTATCGAGATACCCCTCT CNB-INIA
2 NGA361 T16B12 13229491 GA 114 2 2 114 1 2 130 NA NA NA NA NA NA 1 2 114 2 2 114 1 2 114 2 2 140 2 2 114 2 2 114 2 2 125 1 2 114 AAAGAGATGAGAATTTGGAC ACATATCAATATATTAAAGTAGC CNB-INIA
2 MSAT2.7 F7F1 13192607 AG 251 2 2 251 2 2 251 2 2 260 2 2 230 2 2 245 2 2 251 2 2 220 2 2 251 2 2 251 2 2 251 2 2 251 2 2 251 CTCAAATCAAGAACGCTGAC CCCGATATAGACAACGACAA Loudet / CNB-INIA
2 CZSOD2 F24D13 12021590 TA NA NA NA NA 2 2 170 NA NA NA NA NA NA 2 2 200 2 2 190 NA NA NA 2 2 190 2 2 190 NA NA NA 2 2 190 2 2 170 GAATCTCAATATGTGTCAAC GCATTACTCCGGTGTCGTC CNB-INIA
2 NGA1126 F12K12 11703563 GA 190 2 2 190 2 2 216 NA NA NA NA NA NA 2 2 190 2 2 195 2 2 180 2 2 190 2 2 195 2 2 195 2 2 180 2 2 180 CGCTACGCTTTTCGGTAAAG GCACAGTCCAAGTCACAACC CNB-INIA
2 MSAT2.21 F12C20 11461020 AT 286 1 1 286 2 2 240 2 2 240 1 1 286 2 2 240 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA ATTTTTAGCCCAATCACGTTT AGGTCAAGTGAAAGGGTAAGG Loudet
2 PLS9 T1D16 11204134 GTT NA NA NA NA 2 2 77 NA NA NA NA NA NA NA NA NA 2 2 77 2 2 77 2 2 77 2 2 77 2 2 77 2 2 80 2 2 77 GAAATTACGCCGAAAGGTC CGTCACGAGAGGCACATC CNB-INIA
2 ATHGPA1 T1D16 11204101 TC 100 2 2 100 2 2 100 NA NA NA NA NA NA 2 2 100 2 2 100 2 2 100 2 2 100 2 2 100 2 2 100 2 2 100 2 2 100 ATCTCTTATCGTCACGAGAGGC TAAGCAAAGGGGAAGACGAA CNB-INIA
2 MSAT2.37 T19L18 11119089 AT 300 1 1 300 1 1 300 2 1 280 2 1 270 2 1 280 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA GGTTGTTTCATCGAAAGCA CATGGTCTCGCTGGTGTAT Loudet
2 MSAT2.4 T26B15 13831870 AG 288 2 2 288 2 2 220 2 2 250 1 2 250 2 2 220 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA TGGGTTTTTGTGGGTC GTATTATTGTGCTGCCTTTT Loudet
2 ICE12 T7F6 16298711 CT 254 2 2 254 2 2 254 NA NA NA NA NA NA 2 2 254 2 2 254 2 2 254 2 2 254 2 2 254 2 2 254 2 2 254 2 2 254 CTCATGGCAAAAGAGGGAAAA GCTCTCTCACCTCGAACGTC CNB-INIA
2 MSAT2.22 F17A22 19632943 AT 248 2 2 248 2 2 230 2 2 245 2 2 240 2 2 230 2 2 230 2 2 243 2 2 248 2 2 248 2 2 248 2 2 243 2 2 243 CGATCCAATCGGTCTCTCT TGGTAACATCCCGAACTTC Loudet / CNB-INIA
2 MSAT2.33 T9J23 19624991 AT 220 2 2 220 2 1 NA 2 2 210 2 2 215 2 2 205 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA GCTATGCTTTTTCCTGATCT CATTGCCAGAATCTCGAC Loudet
2 ATHUBIQUE T3F17 18882079 AG 146 2 2 146 2 2 146 NA NA NA NA NA NA 2 2 146 2 2 146 2 2 146 2 2 146 2 2 150 2 2 146 2 2 146 2 2 146 AGGCAAATGTCCATTTCATTG ACGACATGGCAGATTTCTCC CNB-INIA
2 MSAT2.9 F18019 18152580 AG 173 2 2 173 2 2 135 2 2 150 2 2 155 1 2 100 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA TAAAAGAGTCCCTCGTAAAG GTTGTTGTTGTGGCATT Loudet
2 ATHBIO2b T1O24 18019881 GA 141 1 2 141 1 1 209 NA NA NA NA NA NA 1 2 145 1 2 135 1 2 141 NA NA NA 1 2 141 1 2 141 NA NA NA 1 2 160 TGACCTCCTCTTCCATGGAG TTAACAGAAACCCAAAGCTTTC CNB-INIA
2 MSAT2.10 T1024 18019832 AG 299 2 2 299 0 NA NA 2 2 370 2 2 340 2 2 299 2 1 289 2 1 344 2 1 344 NA NA NA NA NA NA 0 NA NA 2 2 320 ACAAACATGTTCTGGGTTA ATTCTTCATTATCTGCTGCT Loudet / CNB-INIA
2 C005 T5I17 16592198 T 298 2 2 298 2 2 293 NA NA NA NA NA NA 2 2 293 2 2 293 2 2 293 2 2 293 2 2 NA NA NA NA NA NA NA 2 2 293 AATTATCGCACCTAGTTGAGG TTGTATGAAGGATCATCTGCC CNB-INIA
2 NGA168 T7F6 16298919 GA NA 0 NA NA 2 2 135 NA NA NA NA NA NA 2 2 135 2 2 135 2 2 135 2 2 135 2 2 135 2 2 135 2 2 135 2 2 135 TCGTCTACTGCACTGCCG GAGGACATGTATAGGAGCCTCG CNB-INIA
2 MSAT2.41 T19L18 11095452 AT 144 1 2 144 2 2 100 2 2 115 2 2 95 2 2 100 2 2 100 2 2 120 2 2 145 2 2 100 2 2 100 NA NA NA 2 2 135 GACTGTTTCATCGGATCCAT ACAAACCATTGTTGGTCGTG Loudet / CNB-INIA
2 MSAT2.32 F13B15 10857080 AT 316 2 1 316 2 1 316 2 1 320 2 1 316 2 1 310 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA GATCTATAGCTCGTCAACGG ATCAAGCGTTTTCGTTTTT Loudet
2 MSAT2.28 T26I20 6409845 AT 319 2 2 319 2 2 300 0 NA NA 2 2 310 2 2 305 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA AATAGAAATGGAGTTCGACG TGAACTTGTTGTGAGCTTTG Loudet
2 MSAT2.18 T4E14 2799644 AT 205 1 1 205 2 2 180 1 1 205 2 2 180 2 2 185 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA TAGTCTCTTTTGGTGCGCATA AGCCTCTCCAAGCTTAGGTCT Loudet
2 MSAT2.38 F18P14 2457014 AT 180 2 2 180 2 2 175 2 2 185 2 2 160 2 2 170 2 2 170 2 2 170 2 2 175 2 2 160 2 2 170 2 2 210 2 2 175 TGTAACGCTAATTTAATTGG CGCTCTTTCGCTCTG Loudet / CNB-INIA
2 MSAT2.26 F5G3 1945453 AT 353 2 1 353 2 2 300 2 1 353 1 1 400 2 1 353 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA TCTCCGATTGAGCCCCAAAG CGGGGAAAGATGGGTTTTGA Loudet
2 MSAT2.25 F5G3 1905734 AT 300 2 2 300 2 2 300 2 2 300 2 2 300 2 2 300 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA ATCCGTACCTGAACCCCATC GGTTCGGATTCGGGTTTATC Loudet
2 MSAT2.23 T17M13 889481 AT 286 2 1 286 0 NA NA 2 1 240 0 NA NA 2 1 220 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA ATATAGTGTACGACTTCGCTC TCATCGTTCGGACTTG Loudet
2 NGA1145 T8K22 683625 CT 215 2 2 215 2 2 215 NA NA NA NA NA NA 2 2 205 2 2 205 2 2 205 2 2 205 2 2 205 2 2 205 2 2 205 2 2 205 CCTTCACATCCAAAACCCAC GCACATACCCACAACCAGAA CNB-INIA
2 MSAT2.5 F2I9 208178 AG 227 2 2 227 2 2 220 2 2 170 2 2 175 2 2 160 2 2 160 2 2 160 2 2 160 2 2 160 2 2 160 2 2 160 2 2 155 TGAGAGGGACAGATAGGAA ATCAAAAGGGATACTGACAA Loudet / CNB-INIA
2 MSAT2.29 T26I20 6417505 AT 278 2 1 278 0 NA NA 0 NA NA 0 NA NA 0 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA ATAAAACGTATTTGTTCAAA GAGAATTCTTGGCTATGT Loudet
2 MSAT2.11 F19F24 8227826 AG 315 2 2 315 2 2 305 2 2 290 2 2 270 2 2 270 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA GATTTAAAAGTCCGACCTA CCAAAGAGTTGTGCAA Loudet
2 MSAT2.31 T22F11 10778033 AT 220 2 1 220 2 1 230 2 1 220 2 2 200 2 2 200 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA GCTCCTCTTTGCCGCTAG GCGATTTCATCTTGTGCATC Loudet
2 MSAT2.17 F13D4 10733795 AG 141 1 2 141 1 2 175 1 2 130 1 2 135 1 2 125 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA GATTCCACCATATGTGGAT CTTCGTCACTGCCAATAC Loudet
2 PLS8 T20D16 9934438 TA NA NA NA NA 2 2 144 NA NA NA NA NA NA 2 2 135 NA NA NA NA NA NA 2 2 140 2 2 144 2 2 160 2 2 144 2 2 144 CACAATGATCGCCTTCT TACGGACATGCACTATCAG CNB-INIA
2 PLS7 F21P24 9813750 TA/GA 95 2 2 95 2 2 119 NA NA NA NA NA NA 2 2 90 2 2 100 2 2 80 2 2 119 2 2 95 2 2 90 2 2 90 2 2 95 GATGAATCTTCTCGTCCAAAAT GACAAACTAAACAACATCCTTCTT CNB-INIA
2 PLS6 F7D8 9284871 GTTT NA NA NA NA 2 2 150 NA NA NA NA NA NA 2 2 140 2 2 165 NA NA NA 2 2 140 2 2 140 2 2 140 2 2 150 2 2 140 ATAGTGGGTGATCTTTGAATGTA ACTTGTCTCGTCGCACTGTT CNB-INIA
2 ICE14 F11A3 8769801 GAT 192 2 2 192 2 2 192 NA NA NA NA NA NA 2 2 192 2 2 192 2 2 192 2 2 192 2 2 192 2 2 192 2 2 192 2 2 192 TCGAGGTGCTTTCTGAGGTT3 TACCTCACCCTTTTGACCCA CNB-INIA
2 MSAT2.36 T2G17 8685521 AG 158 2 2 158 2 2 200 2 2 185 2 2 180 2 2 158 2 1 165 2 2 140 2 1 190 2 1 150 2 2 158 2 1 190 2 1 170 GATCTGCCTCTTGATCAGC CCAAGAACTCAAAACCGTT Loudet / CNB-INIA
2 F3PII-6b F27F23 8431233 TA 252 2 2 252 2 2 262 NA NA NA NA NA NA 2 2 245 2 2 252 2 2 243 2 2 243 2 2 243 2 2 248 2 2 210 2 2 243 TTCAATCTTCTCTACTGTCTTCG AGCAGGAAGTAGTAAGTGGAATA CNB-INIA
3 CDC2BG F24B22 20070710 TC 131 2 1 131 2 2 131 NA NA NA NA NA NA 2 2 131 NA NA NA NA NA NA 2 2 131 2 2 131 2 2 131 2 2 131 2 2 131 GGGAAAAACGAAGTGACGTG ATTGAACTGTGTTGGTTTCTGG CNB-INIA
3 F24M12-TGF F26O13 19068356 TA 151 2 2 151 2 2 140 NA NA NA NA NA NA 2 2 140 2 2 140 NA NA NA 2 2 170 2 2 140 2 2 165 2 2 140 2 2 120 GTTCTCTGCATTCCACACATACTCT CTTGGGTATTCTGAAGAGCATAAAT CNB-INIA
3 T16K5-TGF T16K5 18443077 TA NA NA NA NA 2 2 140 NA NA NA NA NA NA 2 2 130 2 2 120 NA NA NA 2 2 140 2 2 130 2 2 130 2 2 130 2 2 140 TTGTCGAAATAAAAATTGACCGTTA TGGATGTGGATTCTATTGTTTCTCA CNB-INIA
3 MSAT3.17 T23J7 17651342 AG 197 2 2 197 0 1 NA 0 1 NA 0 1 NA 0 1 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA GTGATGCAAACGGATAGAGA TCAACAAAAGAGATGGCTGA Loudet
3 F1P2-TGF F1P2 17552222 GA NA NA NA NA 2 2 190 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA 2 2 170 2 2 170 2 2 165 2 2 160 2 2 170 TTTGTCTGAAGATGTGGAGAGAGAG CAAAACCCCACTCTTCATTATTGTT CNB-INIA
3 MSAT3.21 T6H20 17282665 AT 179 2 2 179 2 2 170 0 NA NA 1 2 175 2 2 155 2 2 340 2 2 149 NA NA NA 2 2 179 2 2 179 2 2 149 0 NA NA TGAATCATGGTGCTTCTA TTACCCCGAGCTTGA Loudet / CNB-INIA
3 MSAT3.10 T6H20 17255200 AT 293 2 1 293 2 2 260 2 2 260 2 2 270 2 1 300 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA CTCCATTGGGCAGAGAGAAC TGGCATTGTCCCTATGGG Loudet
3 T27C7-SP6 T8O3 13047019 TA 611 2 2 611 2 2 NA NA NA NA NA NA NA 2 2 611 2 2 611 NA NA NA 2 2 611 2 2 611 2 2 620 2 2 611 2 2 611 ATGCCTAACTATTCGCTGAC TTCTGTAGTTCTTTGTGAGTGC CNB-INIA
3 MSAT3.11 F28P10 20386139 AT 254 2 2 254 2 2 200 2 2 200 2 2 200 2 2 200 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA CGCACTCTCTCGCCTAAGTG CAAATTCCGTGGTCTCGATG Loudet
3 MSAT3.28 T26I12 20467747 AT 210 2 1 210 2 2 175 2 2 200 2 2 190 2 2 180 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA TACAAGTCATAATAGAGGC GGGTTTAGCATTTAGC Loudet
3 NGA112 F26K9 23179348 GA 197 2 2 197 2 2 189 NA NA NA NA NA NA 2 2 189 2 2 189 2 2 189 2 2 189 2 2 189 2 2 189 2 2 189 2 2 189 TAATCACGTGTATGCAGCTGC CTCTCCACCTCCTCCAGTACC CNB-INIA
3 NGA6 T17J13 23042025 GA 143 2 2 143 2 2 123 NA NA NA NA NA NA 2 2 150 2 2 143 2 2 150 2 2 155 2 2 113 2 2 113 2 2 113 2 2 150 TGGATTTCTTCCTCTCTTCAC ATGGAGAAGCTTACACTGATC CNB-INIA
3 ATHFUS6 T20K12 22637844 GT 285 2 2 285 2 2 290 NA NA NA NA NA NA 2 2 285 2 2 290 2 2 290 2 2 290 2 2 290 2 2 285 2 2 290 2 2 290 TCGTTACACTGGCTTGCTTG TTCCTTGATCAGATTTGGTCG CNB-INIA
3 NGA707 T20N10 21763494 TC 132 1 2 132 1 2 128 NA NA NA NA NA NA 1 2 128 1 2 128 1 2 128 1 2 128 1 2 128 1 2 128 1 2 128 1 2 128 TGAATGCGTCCAGTGAGAAG CTCTCTGCCTCTCGCTGG CNB-INIA
3 MSAT3.25 T10K17 21434252 AT 157 1 1 157 0 NA NA 1 1 157 2 2 140 0 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA TTGGGATAAATAAACCAAT CCACACCACAACACATA Loudet
3 MSAT3.18 F15B8 21387949 AT 267 2 2 267 2 2 257 2 2 257 2 2 240 2 2 250 2 2 267 2 2 250 2 2 250 2 2 267 2 2 267 2 2 267 2 2 250 TACCTCAAAAGAGCAAACA TCATACCTACATATTGCCCT Loudet / CNB-INIA
3 MSAT3.13 F15B8 21377089 AT 281 2 2 281 2 2 260 2 2 270 2 2 265 2 2 270 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA TTGTGTGTTTGCGATC CATATCCGTTTTTATGTTTT Loudet
3 MSAT3.29 T26I12 20486867 AT 238 1 2 238 2 2 220 1 2 245 1 2 230 0 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA CGGATGAGATCCAA GACAGAGGTTTACTAATGT Loudet
3 MSAT3.1 MQP15 12170600 AG 213 1 1 213 1 1 220 2 2 200 1 1 200 0 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA GGACTCGCTGCTGCTACATTC CCACGCACATGCAATTACATA Loudet
3 MSAT3.33 MXO21 11221775 AT 154 2 2 154 2 2 135 0 NA NA 2 2 135 2 2 145 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA TGATGAAACCGCATA AATAAAAAGAAGTGGCTA Loudet
3 MSAT3.32 MXO21 11208231 AT 173 2 2 173 2 2 150 0 NA NA 2 2 190 2 2 160 2 2 230 2 2 230 2 2 178 2 2 173 2 2 173 2 2 173 1 2 230 GCACTTGCAGCTTAACTT CGTGACTGTCAAACCG Loudet / CNB-INIA
3 MSAT3.6 MDB19 8467190 AT 289 2 2 289 2 2 280 2 2 260 2 2 280 2 2 275 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA CTACTTTACGCCTTTTATTG TGAATTGTCCCGAGAC Loudet
3 ATDMC1.1 F5N5 8100915 TC NA NA NA NA 2 2 340 NA NA NA NA NA NA 2 2 340 NA NA NA NA NA NA 2 2 340 2 2 340 2 2 340 2 2 340 2 2 340 GCAACTGAATTTGTTTTCGTTTG TTGATTAGTGGATCCGCAAACAA CNB-INIA
3 MSAT3.4 MSD21 7672410 AT 298 2 1 298 1 2 298 2 1 298 2 1 290 2 1 290 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA TGTAACATTCGCATTTTATG CCTCTTCGGTCTATATGACT Loudet
3 NT204 T2O4 5570082 TA 150 2 2 150 2 2 130 NA NA NA NA NA NA 2 2 145 2 2 145 2 2 140 2 2 150 2 2 140 2 2 150 2 2 145 2 2 140 TGGAAGCTCTAGAAACGATCG ACCACCTAAACCGAGAATTGG CNB-INIA
3 NGA162 MDC16 4608284 GA 107 1 2 107 1 2 89 NA NA NA NA NA NA 1 2 89 1 2 120 1 2 107 1 2 89 1 2 89 1 2 85 1 2 89 1 2 89 CATGCAATTTGCATCTGAGG CTCTGTCACTCTTTTCCTCTGG CNB-INIA
3 ATHCHIB2 T2E22 3963391 AT 110 2 2 110 2 2 96 NA NA NA 1 2 100 2 2 90 2 2 96 2 2 91 2 2 96 2 2 96 2 2 91 2 2 96 2 2 125 GGATCCAAGTGCTCATATATAC CTTTCGTTTCTAAATATGAGAAGC Loudet / CNB-INIA
3 NGA172 T21P5 786303 AG 166 2 2 166 2 2 140 2 2 140 2 2 150 2 2 175 2 2 140 2 2 160 2 2 150 2 2 180 2 2 150 2 2 154 2 2 130 CATCCGAATGCCATTGTTC AGCTGCTTCCTTATAGCGTCC Loudet / CNB-INIA
3 NGA32 F1C9 373682 GA 260 2 2 260 2 2 256 NA NA NA NA NA NA 2 2 256 2 2 256 2 2 256 2 2 256 2 2 256 2 2 256 2 2 256 2 2 252 GGAGACTTTTTGAGATTGGCC CCAAAACAATTAGCTCCCCA CNB-INIA
3 MSAT3.5 MDB19 8473561 A 296 2 2 296 2 2 300 2 2 296 2 2 290 2 2 296 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA ACTTGTGTTCTCTAGCTCCA CACTGAGGTCCCGACA Loudet
3 MSAT3.19 K7M2 8808167 AT 171 2 2 171 2 2 120 2 2 120 2 2 190 2 2 200 2 2 176 2 2 166 2 2 166 2 2 166 2 2 166 2 2 166 2 2 156 TAATTCGATCCAATTGACAT TGGCTTGGCACAAAC Loudet / CNB-INIA
3 MSAT3.31 MRI12 11037360 AT 203 2 1 203 0 NA NA 2 1 198 2 2 180 1 2 180 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA CTCTTTTTCTTATGCCAA AGAGTGGGTTGATACCAT Loudet
3 MSAT3.8 K5K13 11002949 AT 353 1 1 353 1 2 335 2 2 315 0 NA NA 2 2 305 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA ATGTTAAAAACCCGTGTTGG TTTAACCTTATCCGGGAAAG Loudet
3 MSAT3.27 MLD15 10879185 AT 234 2 1 234 2 2 190 2 2 190 2 2 190 2 2 190 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA CCAATGAAAGTTTGATTAC AAATGAAAAATTGAGCTAA Loudet
3 MSAT3.23 MFJ20 10603932 AT 140 1 2 140 1 2 110 1 2 120 0 NA NA 1 2 140 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA CATGAACACATATTTGTAA ATCTCCAATTTTCCC Loudet
3 MSAT3.30 K24A2 10378795 AT 156 1 1 156 1 1 160 2 2 130 2 2 135 1 1 165 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA TTGTTTAACAACGGTTGC AAATTGGGTACGAGACCA Loudet
3 MSAT3.20 MMJ24 10189282 A 278 2 2 278 2 2 250 2 2 245 2 2 250 2 2 270 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA ATGAGTGGAAGAGATGGCTC GGTACGCCGAAAGGG Loudet
3 ATHGAPAb MLJ15 9796459 TTC 142 2 2 142 2 2 150 NA NA NA NA NA NA 2 2 150 2 2 150 2 2 142 2 2 150 2 2 150 2 2 150 2 2 142 2 2 142 CACCATGGCTTCGGTTACTT TCCTGAGAATTCAGTGAAACCC CNB-INIA
3 MSAT3.2 K7P8 9055511 AG 211 2 2 211 2 2 195 2 2 215 0 NA NA 2 2 200 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA AAGGTACGGCGGTGGATATTG CGGGGATTTCTTCTTCCTGTG Loudet
4 NGA1139 F10M10 16444155 CT 150 2 2 150 2 2 160 NA NA NA NA NA NA 2 2 160 2 2 108 2 2 140 2 2 98 2 2 140 2 2 140 2 2 98 2 2 130 TAGCCGGATGAGTTGGTACC TTTTTCCTTGTGTTGCATTCC CNB-INIA
4 MSAT4.12 F4I10 15960078 AG 240 2 2 240 2 2 235 2 2 230 2 2 225 2 2 215 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA AAAGGAAGAAGAAGACTGTT AGAAGAAGAAGCGAGATT Loudet
4 MSAT4.9 F4D11 15790523 AG 235 1 2 235 1 2 230 1 2 230 1 2 220 1 2 250 2 2 250 2 2 205 2 2 220 2 2 200 2 2 260 2 2 260 2 2 235 GAAATCAACGGCTGAG AAGTAATTAAGACGCTGAGA Loudet / CNB-INIA
4 MSAT4.11 F10N7 15464780 AG 247 2 2 247 2 2 240 2 2 245 2 2 230 2 2 225 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA AAAAATCCGGTAGAGCATCC CCAATTCCGAGCCAGTAA Loudet
4 MSAT4.13 F28M20 15297044 AG 226 2 2 226 2 2 220 2 2 230 2 2 220 2 2 215 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA GGAACAAGAACACAGTGAA ATAAATCTAGGCAGGACAAG Loudet
4 MSAT4.14 F8F16 15212515 AG 165 2 2 165 2 2 165 2 2 175 2 2 165 2 2 175 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA GACCGTTTCTAGTGCTCACA ACGGAATAAGCGGAGGA Loudet
4 LT5 F20M23 13538483 TA 522 2 2 522 2 2 522 NA NA NA NA NA NA 2 2 522 2 2 522 2 2 522 2 2 522 2 2 522 2 2 522 2 2 522 2 2 522 AGATGCAACAATAAGATGTTGAGG GAGATCTGCGATGGTGAAATTG CNB-INIA
4 MSAT4.19 F7H19 12093223 AT 237 2 2 237 0 NA NA 2 2 237 2 2 210 2 2 210 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA TGAACTAAAGACTTGATGCC CCAAACGCAAATAGTGTT Loudet
4 MSAT4.33 F6G17 17611370 AG 127 2 2 127 2 2 120 2 2 100 2 2 150 2 2 140 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA TTCTTTGACACGCAAACA TGGTGACATAGACCCAATG Loudet
4 MSAT4.21 F19F18 17689148 AT 161 2 1 161 2 2 140 2 1 150 2 2 140 2 1 130 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA TTATGCTATGGCTGTTTGGT CGAAATCTGTTCTTGCATTC Loudet
4 MSAT4.30 F20D10 17850661 A 189 2 2 189 2 2 180 2 2 175 2 2 178 2 2 178 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA AGAGCACTCACCGTTCAT TGTGTTCGTGGATTTACC Loudet
4 MSAT4.31 T5J17 18573159 AG 238 2 2 238 2 2 160 2 2 245 2 2 240 0 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA AGGGATATGGATTGAGA GCCGTATAACTATTGGTT Loudet
4 MSAT4.23 T5J17 18532252 AT 280 2 1 280 1 1 NA 1 1 NA 2 1 280 1 1 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA GCTTGCCTTTTCTTTCTCAT GGTTCAATTGGAGGCGTAG Loudet
4 MSAT4.28 T5J17 18510594 AG 191 2 2 191 2 2 140 2 2 140 0 NA NA 0 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA GAAGCTTCCGCGTGAC TGAATTGATGTCGCAATCAG Loudet
4 MSAT4.38 F23K16 18412248 AT 179 2 1 179 2 1 190 2 1 200 2 1 190 0 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA GCCTTATAGTACACCCAAA CCACTCCACTCTCGAA Loudet
4 MSAT4.37 F23K16 18336495 AT 139 2 2 139 2 2 130 2 2 130 1 1 160 2 2 135 2 2 139 2 2 149 2 2 139 2 2 129 2 2 129 2 2 139 2 2 129 CGTTTCATCAAGTTCCGA TAGGAGGTTATCATGCGTG Loudet / CNB-INIA
4 MSAT4.20 F19H22 18203091 AT 317 1 2 317 1 2 317 1 2 317 0 NA NA 0 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA GTTAATTTGATTAGAAGTTT GGTGTTCCTATATTGG Loudet
4 MSAT4.27 T9A14 18096323 AG 218 2 2 218 2 2 200 2 2 200 2 2 200 2 2 200 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA CCAGAGCGACGAATC GCCCAATATGAATTACTAAT Loudet
4 NGA1107 T9A14 18096131 GA 150 2 2 150 2 2 140 NA NA NA NA NA NA 2 2 140 2 2 140 2 2 140 2 2 140 2 2 140 2 2 140 2 2 140 2 2 140 GCGAAAAAACAAAAAAATCCA CGACGAATCGACAGAATTAGG CNB-INIA
4 MSAT4.18 T12H17 11966304 AT 159 2 2 159 1 2 150 2 2 145 2 2 135 2 2 155 2 2 140 2 2 140 2 2 143 2 2 135 2 2 135 NA NA NA 2 1 143 TGTAAATATCGGCTTCTAAG CTGAAACAAATCGCATTA Loudet / CNB-INIA
4 CIW7 F17L22 11524362 TA 130 2 2 130 2 2 123 NA NA NA NA NA NA 2 2 105 2 2 100 2 2 100 2 2 100 2 2 100 2 2 110 2 2 100 2 2 100 AATTTGGAGATTAGCTGGAAT CCATGTTGATGATAAGCACAA CNB-INIA
4 MSAT4.10 T6K21 9969057 AG 223 2 2 223 2 2 223 2 2 230 2 2 240 2 2 215 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA GGTAATTTTCTTGGAGACCC CTAACTAGATCGTCCCTCGT Loudet
4 NGA1111 T25P22 6089581 TC 148 2 2 148 2 2 154 NA NA NA NA NA NA 2 2 164 2 2 148 2 2 154 2 2 148 2 2 148 2 2 164 2 2 154 2 2 154 GGGTTCGGTTACAATCGTGT AGTTCCAGATTGAGCTTTGAGC CNB-INIA
4 NGA8 T32A17 5628810 AG 157 2 2 157 2 2 200 2 2 166 2 2 145 2 2 160 2 1 198 2 1 144 2 1 164 2 1 198 2 1 164 2 1 164 2 1 154 GAGGGCAAATCTTTATTTCGG TGGCTTTCGTTTATAAACATCC Loudet / CNB-INIA
4 NGA12n T1J24 2804321 GA 295 2 1 295 2 1 295 NA NA NA NA NA NA 2 1 295 2 1 290 2 1 295 2 1 295 2 1 295 2 1 295 NA NA NA 2 1 295 TAATGTTGTTTCCCCTCCTCG CACTGAACCTGAATCGGCG CNB-INIA
4 MSAT4.3 F11O4 659403 AG 130 1 2 130 1 1 140 2 2 130 2 2 130 2 2 130 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA ATTTCTCACATTTTGACGGT CATGTTGATTTCTTACGCA Loudet
4 MSAT4.8 T18A10 407010 AG 202 2 2 202 2 2 190 2 2 195 2 2 190 2 2 175 2 2 202 2 2 195 2 2 202 2 2 190 2 2 190 2 2 195 2 2 195 GTTGGGTTTAGTTGGTAACA CGGGTAAAGACAGAGCAT Loudet / CNB-INIA
4 MSAT4.39 F6N15 89498 AT 161 2 1 161 2 2 135 2 1 155 2 2 140 2 1 150 2 2 161 2 2 135 2 2 135 2 2 135 2 2 130 2 2 130 2 2 130 GTTATCACATTAAAATCACC CCAATTGTAATATATGAACA Loudet / CNB-INIA
4 MSAT4.42 F6N15 75273 AG 130 2 2 130 2 2 130 2 2 130 2 2 130 2 2 130 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA CAGAAGTTGAAGTCCAGAGA GCCAATTTGTTTAGGTACAG Loudet
4 MSAT4.41 F6N15 42208 AT 145 1 2 145 1 2 155 1 2 145 1 2 150 1 2 170 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA CCTACACTCATCAGATTCAG TAATTAGGGTTTGATCATTC Loudet
4 ATHDET1 F24G24 6346349 CT 138 2 2 138 2 2 136 NA NA NA NA NA NA 2 2 138 2 2 138 2 2 138 2 2 138 2 2 138 2 2 138 2 2 138 2 2 138 TTCAAACACCAATATCAGGCC GGTGAAAATGGAGGAGACGA CNB-INIA
4 ICE7 F25E4 6946956 GAA 130 2 2 130 2 2 125 NA NA NA NA NA NA 2 2 125 2 2 130 2 2 140 2 2 130 2 2 125 2 2 125 2 2 125 2 2 125 TTCAAGGGCAGGATCAAAAC GTCTCACTGCTATCGTCACAGG CNB-INIA
4 MSAT4.25 F25E4 6975907 T 229 2 2 229 2 2 220 2 2 200 2 2 210 2 2 210 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA GAATGGTTGTTGATAGTTGA AAATTTCAGGAGGTGATAGA Loudet
4 MSAT4.15 FCA6 9362588 AG 174 2 2 174 2 2 150 2 2 155 2 2 165 2 2 147 2 2 174 2 2 160 NA NA NA 2 2 160 2 2 145 2 2 150 2 2 150 TTTCTTGTCTTTCCCCTGAA GACGAAGAAGGAGACGAAAA Loudet / CNB-INIA
4 CIW6 T6G15 7892620 CTT NA NA NA NA 2 2 150 NA NA NA NA NA NA 2 2 155 2 2 160 NA NA NA NA NA NA 2 2 140 2 2 155 2 2 140 2 2 135 CTCGTAGTGCACTTTCATCA CACATGGTTAGGGAAACAATA CNB-INIA
4 MSAT4.36 F25G13 7623931 AT 172 2 2 172 0 NA NA 0 NA NA 0 NA NA 0 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA TATTTCGGTGAAGACAGAA GCCTTGCATAAACCAA Loudet
4 MSAT4.35 F25G13 7549254 AT 217 2 1 217 2 2 170 2 2 180 2 2 200 2 2 180 2 2 160 2 2 140 NA NA NA 2 2 160 2 2 165 NA NA NA 2 2 200 CCCATGTCTCCGATGA GGCGTTTAATTTGCATTCT Loudet / CNB-INIA
4 MSAT4.32 T1P17 7360315 A 304 0 NA NA 0 NA NA 0 NA NA 0 NA NA 0 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA GATTTCCATATATTTGATT TGGGTAAAATGATTTC Loudet
4 MSAT4.29 F16J13 7178405 AT 211 2 1 211 0 NA NA 0 NA NA 0 NA NA 2 1 200 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA AGGAACTAATTGCGATAA AGTCCGATTCATAATTGT Loudet
4 MSAT4.17 T26M18 7147724 AT 363 2 1 363 2 1 380 2 1 363 2 1 345 2 1 345 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA GCTGAAAATTCAGTTCCGTT GCTTCTTCATTTGTTCTTGC Loudet
4 MSAT4.16 T26M18 7143278 AT 273 2 2 273 2 2 260 2 2 240 2 2 250 2 2 250 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA AGGTGGAGATTGTTCTTGTT CGTTGCGTTCTCTATCCTC Loudet
5 MSAT5.10 K17N15 20937065 AT 272 2 2 272 2 2 260 2 2 260 2 2 270 0 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA GTTGCTTCTTTTGCTAACT ATCGTTCACGCAATAAG Loudet
5 NGA129 K6M13 20133116 GA 177 2 2 177 2 2 179 NA NA NA NA NA NA 2 2 160 2 2 170 2 2 175 NA NA NA 2 2 170 2 2 170 2 2 170 2 2 170 TCAGGAGGAACTAAAGTGAGGG CACACTGAAGATGGTCTTGAGG CNB-INIA
5 MSAT5.4 K9L2 17844441 AT 261 1 1 261 2 2 240 2 2 220 2 2 225 2 2 235 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA TCAACCCTAGATGGTGTCGAT TTCAATCATTTTTGCCGTGA Loudet
5 MSAT5.3 MNL12 17380739 AG 292 2 2 292 2 2 280 2 2 280 2 2 285 2 2 280 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA CTCAGCCGCAAATGGATGTCT CTTAGCGTCGCACACACCACA Loudet
5 MSAT5.9 MBD2 17252309 AG 208 2 2 208 2 2 225 2 2 208 2 2 195 2 2 180 2 2 225 2 2 240 2 2 218 2 2 215 2 2 225 2 2 215 2 2 240 CGTCATTTTTCGCCGCTCT CATGGTGGCGCGTAGCTTA Loudet / CNB-INIA
5 MSAT5.8 MJB21 17163228 AT 322 1 2 322 1 2 322 2 2 300 2 2 300 1 2 340 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA GAAACATTTCATGGGCTTT GAGAGCAGAGGCAAGTCA Loudet
5 MSAT5.7 MFO20 17071433 AT 265 1 1 265 2 2 220 2 2 225 2 2 210 2 2 230 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA GCTTGTACATTACCGGACA CCAAGCGTACTCGATCA Loudet
5 CIW9 MFO20 17061229 TA 165 2 2 165 2 2 145 NA NA NA NA NA NA 2 2 175 2 2 170 NA NA NA 2 2 160 2 2 150 2 2 145 2 2 160 2 2 160 CAGACGTATCAAATGACAAATG GACTACTGCTCAAACTATTCGG CNB-INIA
5 ICE9 MFO20 16151501 CTT 154 2 2 154 2 2 134 NA NA NA NA NA NA 2 2 144 2 2 134 2 2 134 2 2 134 2 2 124 2 2 130 2 2 130 2 2 134 TTTCCCCACACAAAATCTCC TTCCTTGCTCAAATTGAAGG CNB-INIA
5 ICE3 MPO12 16144941 CT 114 2 2 114 2 2 110 NA NA NA NA NA NA 2 2 150 2 2 110 2 2 150 2 2 134 2 2 140 2 2 120 2 2 140 2 2 75 GACTAATCATCACCGACTCAGCCAC ATTCTTCTTCACTTTTCTTGATCCCG CNB-INIA
5 ATHS0191 F14C23 15021915 ATG 166 2 2 166 2 2 156 NA NA NA NA NA NA 2 2 156 2 2 156 2 2 146 2 2 156 2 2 156 2 2 156 2 2 156 2 2 156 TGATGTTGATGGAGATGGTCA CTCCACCAATCATGCAAATG CNB-INIA
5 MSAT5.12 MXC20 21424928 AT 155 2 2 155 2 2 145 2 2 155 2 2 130 2 2 145 0 NA NA 2 2 140 0 NA NA 0 NA NA 2 2 145 0 NA NA 2 2 140 GCATATTGTTGATAGAAAA AGCCAATGAATCGTT Loudet / CNB-INIA
5 MSAT5.13 K19P17 21944845 AT 304 1 1 304 2 1 285 2 2 280 2 1 290 0 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA GTTTCTTGGCTACTCCCAT TTTGTGTTGGCTTAGTCGT Loudet
5 MSAT5.17 MXK3 25973071 AT 356 2 1 356 2 1 335 1 1 NA 2 1 356 2 1 360 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA TTCGATTTTGTTGATTGAAT AGCGGTTATCGGAAACT Loudet
5 MSAT5.19 MXK3 25924795 AT 208 2 2 208 2 2 190 2 2 180 2 2 175 2 2 185 2 2 188 2 2 185 2 2 189 2 2 195 2 2 200 2 2 188 2 2 188 AACGCATTTGCTGTTTCCCA ATGGTTATCTCATCTGGTCT Loudet / CNB-INIA
5 MHJ24 MHJ24 25676331 ATT 175 2 2 175 2 2 180 NA NA NA NA NA NA NA NA NA 2 2 175 NA NA NA 2 2 155 2 2 180 2 2 165 2 2 165 NA NA NA CCGTCCTTGATCCTTGAGATTCTGAG CAATTCCGAAAATCATATTCATGCACC CNB-INIA
5 ICE8 MBK5 25494981 CTT 99 2 2 99 2 2 79 NA NA NA NA NA NA 2 2 94 2 2 89 2 2 109 2 2 99 2 2 89 2 2 99 NA NA NA 2 2 69 GTGTTACCGATCTGGCTCTG TCAGCTTGAGCATTTCACAG CNB-INIA
5 CIW10 MSL3 24548097 TA NA NA NA NA 2 2 130 NA NA NA NA NA NA NA NA NA 2 2 145 NA NA NA 2 2 145 2 2 120 2 2 150 2 2 150 2 2 160 CCACATTTTCCTTCTTTCATA CAACATTTAGCAAATCAACTT CNB-INIA
5 JV75/76 MNC17 23879358 TA 87 2 2 87 2 2 124 NA NA NA NA NA NA 2 2 114 NA NA NA NA NA NA 2 2 100 2 2 100 2 2 100 2 2 90 2 2 100 CACAATCAGAGGGGGTTGAT AAATTTTGGGGGAAATGAAA CNB-INIA
5 ICE4 K18M22 23837141 CT 200 2 2 200 2 2 210 NA NA NA NA NA NA 2 2 220 2 2 200 2 2 200 2 2 200 2 2 220 2 2 220 2 2 200 2 2 210 CACGAGGAATCTGGCATGGTCG AGCGATTGCAAGCGGCTCAAG CNB-INIA
5 JV61/62 MDF20 22527623 TA 205 2 2 205 2 2 185 NA NA NA NA NA NA 2 2 165 2 2 215 2 2 195 2 2 170 2 2 195 2 2 195 2 2 195 2 2 195 CGCTTTCCTTGTGTCATTCC AAATGCAAATATTGATGTGTGAAA CNB-INIA
5 MSAT5.5 MTE17 22491371 AG 154 2 2 154 2 2 154 2 2 145 2 2 154 2 2 154 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA CGATCATATAAATTCGAATCC GATTATCTCGCATGTTTATCA Loudet
5 JV65/66 MDK4 22027830 TA 196 2 2 196 2 2 176 NA NA NA NA NA NA 2 2 186 NA NA NA 2 2 196 NA NA NA NA NA NA NA NA NA NA NA NA 2 2 210 TTTCTTTCACGGTTTCTAACTTTT TCATCTTCCCTTTAATTCTGATGA CNB-INIA
5 MSAT5.18 MPA24 26321176 AT 291 2 1 291 2 2 260 2 1 285 2 2 260 1 1 260 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA GATTATAGGTTATTTTCGTT ACAGAAGAACCGATTC Loudet
5 MSAT5.23 MAB16 14199812 AG 174 2 2 174 2 2 155 0 NA NA 0 NA NA 0 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA TTGATCCAATAAGTGCTG CCTAAACACCCTCAACTA Loudet
5 ATHPHYC MIK22 14025127 NA 207 2 2 207 2 2 222 NA NA NA NA NA NA 2 2 222 2 2 222 2 2 222 2 2 222 2 2 207 2 2 222 2 2 222 2 2 222 CTCAGAGAATTCCCAGAAAAATCT AAACTCGAGAGTTTTGTCTAGATC CNB-INIA
5 MSAT5.21 MRG7 6047245 AT 223 2 2 223 1 2 223 0 NA NA 0 NA NA 2 2 300 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA CAATAGACCAGAGTTGTG AAGACTGCCCATCAT Loudet
5 ICE1 MQK4 5397401 GA 95 2 2 95 2 2 64 NA NA NA NA NA NA 2 2 67 2 2 75 2 2 67 2 2 75 2 2 67 2 2 67 2 2 75 2 2 67 GAAGAAACGAAGACGAAGAAGTCG CCCTTTTGTTCTTCTCCTTTCTC CNB-INIA
5 NGA106 MQK4 5397351 GA 157 1 2 157 1 2 123 NA NA NA NA NA NA 1 2 123 1 2 123 1 2 123 1 2 123 1 2 123 1 2 123 1 2 123 1 2 123 GTTATGGAGTTTCTAGGGCACG TGCCCCATTTTGTTCTTCTC CNB-INIA
5 NGA151 F18022 4669932 AG 150 2 2 150 2 2 120 2 2 100 NA NA NA 2 2 115 2 2 134 2 2 160 2 2 140 2 2 115 2 2 115 2 2 120 2 1 150 GTTTTGGGAAGTTTTGCTGG CAGTCTAAAAGCGAGAGTATGATG Loudet / CNB-INIA
5 CA72 T31B5 4254762 CA 240 2 2 240 2 2 230 NA NA NA NA NA NA 2 2 230 2 2 230 2 2 230 2 2 230 2 2 230 2 2 230 2 2 230 2 2 230 AATCCCAGTAACCAAACACACA CCCAGTCTAACCACGACCAC CNB-INIA
5 NGA249 MAH20 2770217 AG 125 2 2 125 2 2 115 2 2 115 2 2 150 2 2 110 2 2 110 2 2 110 2 2 110 2 2 110 2 2 110 2 2 110 2 2 110 TACCGTCAATTTCATCGCC GGATCCCTAACTGTAAAATCCC Loudet / CNB-INIA
5 MOJB MOJ9 2190103 T 174 2 2 174 2 2 134 NA NA NA NA NA NA 2 2 134 2 2 134 NA NA NA 2 2 134 2 2 134 2 2 134 2 2 134 2 2 134 TGAAAGATTTTAGGAGGACAA GTAGGAGAAGGGGACAAGTT CNB-INIA
5 NGA158 MJJ3 1698614 AG 108 2 2 108 2 2 105 2 2 120 NA NA NA 1 2 180 1 2 180 NA NA NA NA NA NA 1 2 180 NA NA NA NA NA NA 1 2 180 ACCTGAACCATCCTCCGTC TCATTTTGGCCGACTTAGC Loudet / CNB-INIA
5 NGA225 MUG13 1507104 AG 120 2 2 120 2 2 190 2 2 120 2 2 120 2 2 100 2 2 119 2 2 129 NA NA NA 2 2 109 2 2 119 2 2 140 2 2 135 GAAATCCAAATCCCAGAGAGG TCTCCCCACTAGTTTTGTGTCC Loudet / CNB-INIA
5 MED24D MED24 1002256 T 302 2 2 302 2 2 287 NA NA NA NA NA NA 2 2 302 2 2 287 NA NA NA 2 2 302 2 2 302 2 2 302 2 2 285 2 2 302 GGGGGACCTTTTTCTTGATTACC GCAGAGTCTCACTCTCATCTCC CNB-INIA
5 MSAT5.14 MQJ16 7498509 AT 221 2 2 221 2 2 210 2 2 170 2 2 200 2 2 230 2 2 215 2 2 220 2 2 215 2 2 220 2 2 200 2 2 220 2 2 225 AACAACCCTATCTTCTTCTG TGTGACCCCTTACTCAATA Loudet / CNB-INIA
5 ICE5 T20O7 7705251 GT 170 2 2 170 2 2 200 NA NA NA NA NA NA 2 2 170 2 2 170 2 2 240 2 2 170 2 2 200 2 2 185 2 2 170 2 2 170 CTTGCAACCGCCAACTCAATCG CCTGTCTCGCTCCCGCACG3 CNB-INIA
5 MSAT5.2 MIK22 13998728 AT 209 1 1 209 0 NA NA 2 1 200 2 1 190 2 2 160 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA TCTCAGACATGGAAATCTTGT GGCATTTTTAACACTTTCAAA Loudet
5 MSAT5.22 MWP19 13961061 AT 248 2 1 248 2 1 300 2 1 248 2 1 240 2 1 310 2 2 325 2 2 315 0 NA NA 2 2 325 2 2 325 2 2 280 2 2 270 AGAACAAGTTAGGTGGCT GGGACAAGAATGGAGT Loudet / CNB-INIA
5 MSAT5.1 MXH1 13924203 AT 300 2 1 300 2 2 270 2 1 300 1 1 310 2 1 280 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA TCTAGCTTTATCCTTCTTTGA GCCTATTCCGAGATTCA Loudet
5 MSAT5.25 MOK9 13722916 AT 162 2 2 162 2 2 180 2 2 170 2 2 190 0 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA GCTTAATTTGGGTTAAAT GCACGCAAGTGACT Loudet
5 NGA76 F24J2 10418614 GA 250 2 2 250 2 2 350 NA NA NA NA NA NA 0 NA NA 0 NA NA 1 2 260 0 NA NA 0 NA NA 2 2 300 0 NA NA 0 NA NA GGAGAAAATGTCACTCTCCACC AGGCATGGGAGACATTTACG CNB-INIA
5 ATHS0262 T1g16 9792771 CTT 145 2 2 145 2 2 159 NA NA NA NA NA NA 0 NA NA 2 2 150 2 2 155 2 2 140 2 2 150 2 2 145 2 2 145 2 2 140 TTGCTTTTTGGTTATATTCGGA ATCATCTGCCCATGGTTTTT CNB-INIA
5 ICE15 T1N24 9081781 TA NA NA NA NA 2 2 250 NA NA NA NA NA NA NA NA NA NA NA NA NA NA 250 2 2 250 2 2 260 NA NA NA 2 2 250 2 2 250 CACACTAAATTATCTATCAACT CCTGCTCCTCTTTCCTTCTGCTC CNB-INIA
5 NGA139 K18P6 8428136 AG 182 2 2 182 2 2 130 2 2 130 2 2 200 2 2 130 2 2 132 2 2 169 2 2 152 2 2 152 2 2 132 2 2 152 2 2 142 GGTTTCGTTTCACTATCCAGG AGAGCTACCAGATCCGATGG Loudet / CNB-INIA
5 ICE2 K18P6 8428121 CT 190 2 2 190 2 2 144 NA NA NA NA NA NA 2 2 190 2 2 144 2 2 NA 2 2 164 2 2 164 2 2 144 2 2 164 2 2 154 CTCGGGTCAAAATTAGGGTTTCG GCTACCAGATCCGATGGTAAGATG CNB-INIA
5 ATHCDPK9 MQM1 7952515 TC 106 2 2 106 2 2 110 NA NA NA NA NA NA 2 2 106 2 2 144 2 2 115 2 2 115 2 2 106 2 2 106 2 2 134 2 2 110 TCAATCATTGTCCAAAACTTGG GAAACTGACTTGGAGAAGGCA CNB-INIA
5 ATHCTR1A F17C15 979763 AG 145 2 2 145 2 2 150 NA NA NA NA NA NA NA NA NA 2 2 145 NA NA NA 2 2 150 2 2 135 0 NA NA 0 NA NA 2 2 145 TATCAACAGAAACGCACCGAG CCACTTGTTTCTCTCTCTAG CNB-INIA

   Page: 1 of 214  Records: 214
 

© INRA 2007
home -